Mature sequence bta-miR-507b

Accession numberMIMAT0046744
IDbta-miR-507b
Stem-Loop bta-mir-507b
Sequence
ugauugguacuucuuagagugga
Get sequence
Deep sequencing12 reads, 6 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).