Mature sequence bta-miR-12045

Accession numberMIMAT0046743
IDbta-miR-12045
Stem-Loop bta-mir-12045
Sequence
acccgggaagucccugacacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).