Mature sequence bta-miR-12044

Accession numberMIMAT0046742
IDbta-miR-12044
Stem-Loop bta-mir-12044
Sequence
aauggauuacuucugauugcu
Get sequence
Deep sequencing117 reads, 50 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).