Mature sequence bta-miR-12043

Accession numberMIMAT0046740
IDbta-miR-12043
Stem-Loop bta-mir-12043
Sequence
ccuccagggcuaggaggugg
Get sequence
Deep sequencing5 reads, 5 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).