Mature sequence bta-miR-12042

Accession numberMIMAT0046739
IDbta-miR-12042
Stem-Loop bta-mir-12042
Sequence
ugugucuuuccuucugugugugcu
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).