Mature sequence bta-miR-191b

Accession numberMIMAT0046738
IDbta-miR-191b
Stem-Loop bta-mir-191b
Sequence
gaacgaaauccaagcgcagcug
Get sequence
Deep sequencing180 reads, 61 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).