Mature sequence bta-miR-12041

Accession numberMIMAT0046737
IDbta-miR-12041
Stem-Loop bta-mir-12041
Sequence
acugaaggccuugcaccucugaau
Get sequence
Deep sequencing12 reads, 12 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).