Mature sequence bta-miR-12040

Accession numberMIMAT0046735
IDbta-miR-12040
Stem-Loop bta-mir-12040
Sequence
cacaugggcaacgaauaauuuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).