Mature sequence bta-miR-12039

Accession numberMIMAT0046734
IDbta-miR-12039
Stem-Loop bta-mir-12039
Sequence
ccagggcccuggcuucuucucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).