Mature sequence bta-miR-12038

Accession numberMIMAT0046733
IDbta-miR-12038
Stem-Loop bta-mir-12038
Sequence
ucugcagaagcugucagugccu
Get sequence
Deep sequencing3 reads, 3 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).