Mature sequence bta-miR-12037

Accession numberMIMAT0046732
IDbta-miR-12037
Stem-Loop bta-mir-12037
Sequence
cauucugucuucucuuuagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).