Mature sequence bta-miR-12036

Accession numberMIMAT0046731
IDbta-miR-12036
Stem-Loop bta-mir-12036
Sequence
cggcuccgugacucguccguggac
Get sequence
Deep sequencing20 reads, 14 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).