Mature sequence bta-miR-12033

Accession numberMIMAT0046726
IDbta-miR-12033
Stem-Loop bta-mir-12033
Sequence
ugcccugggaguguaaauauugg
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).