Mature sequence bta-miR-12032

Accession numberMIMAT0046725
IDbta-miR-12032
Stem-Loop bta-mir-12032
Sequence
ucuggccuggagaagcccugg
Get sequence
Deep sequencing21 reads, 14 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).