Mature sequence bta-miR-12031

Accession numberMIMAT0046724
IDbta-miR-12031
Stem-Loop bta-mir-12031
Sequence
auuggagccagucugcagaagc
Get sequence
Deep sequencing6 reads, 4 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).