Mature sequence bta-miR-12026

Accession numberMIMAT0046719
IDbta-miR-12026
Stem-Loop bta-mir-12026-1 bta-mir-12026-2
Sequence
cccggggacugcuggccagg
Get sequence
Deep sequencing3 reads, 2 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).