Mature sequence bta-miR-12025

Accession numberMIMAT0046718
IDbta-miR-12025
Stem-Loop bta-mir-12025
Sequence
ucgcgggguuuugcagaggacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).