Mature sequence bta-miR-12017

Accession numberMIMAT0046697
IDbta-miR-12017
Stem-Loop bta-mir-12017
Sequence
acagaggagcuuuugacaugaac
Get sequence
Deep sequencing10 reads, 9 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).