Mature sequence bta-miR-12002b

Accession numberMIMAT0046694
IDbta-miR-12002b
Stem-Loop bta-mir-12002b
Sequence
ccucauguggaaucuuuagcu
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).