Mature sequence bta-miR-2285cr

Accession numberMIMAT0046691
IDbta-miR-2285cr
Stem-Loop bta-mir-2285cr-1 bta-mir-2285cr-2
Sequence
aaaaguucguucagguuucu
Get sequence
Deep sequencing11435 reads, 74 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).