Mature sequence bta-miR-12014

Accession numberMIMAT0046689
IDbta-miR-12014
Stem-Loop bta-mir-12014
Sequence
ugccacgggcugggccuuggga
Get sequence
Deep sequencing19 reads, 14 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).