Mature sequence bta-miR-6501

Accession numberMIMAT0046685
IDbta-miR-6501
Stem-Loop bta-mir-6501
Sequence
ccagggcagccugugguaacagu
Get sequence
Deep sequencing5 reads, 3 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).