Mature sequence bta-miR-12012

Accession numberMIMAT0046680
IDbta-miR-12012
Stem-Loop bta-mir-12012
Sequence
gugcucuagagcucacaggcc
Get sequence
Deep sequencing2 reads, 1 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).