Mature sequence bta-miR-12011

Accession numberMIMAT0046679
IDbta-miR-12011
Stem-Loop bta-mir-12011
Sequence
gagagcccaugagacucaaaca
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).