Mature sequence bta-miR-12009

Accession numberMIMAT0046677
IDbta-miR-12009
Stem-Loop bta-mir-12009
Sequence
aacaagcaaguucccuccacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).