Mature sequence bta-miR-6775

Accession numberMIMAT0046673
IDbta-miR-6775
Stem-Loop bta-mir-6775
Sequence
cauggucccuguucucugccccaga
Get sequence
Deep sequencing29 reads, 21 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).