Mature sequence bta-miR-12001

Accession numberMIMAT0046660
IDbta-miR-12001
Stem-Loop bta-mir-12001
Sequence
ccugugagggcuucacccugga
Get sequence
Deep sequencing9 reads, 7 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).