Mature sequence bta-miR-11999

Accession numberMIMAT0046658
IDbta-miR-11999
Stem-Loop bta-mir-11999
Sequence
ucagacccauauucucauaggc
Get sequence
Deep sequencing168 reads, 39 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).