Mature sequence bta-miR-2285cd

Accession numberMIMAT0046655
IDbta-miR-2285cd
Stem-Loop bta-mir-2285cd
Sequence
aacaaccuggaugaacuuuuugg
Get sequence
Deep sequencing120 reads, 53 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).