Mature sequence bta-miR-11993

Accession numberMIMAT0046634
IDbta-miR-11993
Stem-Loop bta-mir-11993
Sequence
gaccugugcguguacacucaug
Get sequence
Deep sequencing11 reads, 10 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).