Mature sequence bta-miR-11992

Accession numberMIMAT0046632
IDbta-miR-11992
Stem-Loop bta-mir-11992
Sequence
uccuaggggauugacauagucugu
Get sequence
Deep sequencing79 reads, 37 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).