Mature sequence bta-miR-11990

Accession numberMIMAT0046629
IDbta-miR-11990
Stem-Loop bta-mir-11990
Sequence
uaggcagagaugacagucauacu
Get sequence
Deep sequencing31 reads, 21 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).