Mature sequence bta-miR-11989

Accession numberMIMAT0046628
IDbta-miR-11989
Stem-Loop bta-mir-11989
Sequence
cccagggauguagcuccuagugc
Get sequence
Deep sequencing78 reads, 44 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).