Mature sequence bta-miR-11986b

Accession numberMIMAT0046621
IDbta-miR-11986b
Stem-Loop bta-mir-11986b
Sequence
uuuuccaaugaguuaguccuuu
Get sequence
Deep sequencing2225 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).