Mature sequence bdo-miR-309a

Accession numberMIMAT0045448
IDbdo-miR-309a
Stem-Loop bdo-mir-309a
Sequence
ucacuggguaaaguuuguccca
Get sequence
Deep sequencing reads, experiments

References

1