Mature sequence bdo-miR-318

Accession numberMIMAT0045437
IDbdo-miR-318
Stem-Loop bdo-mir-318
Sequence
ucacugggcuuuguuuaucuca
Get sequence
Deep sequencing reads, experiments

References

1