Mature sequence bdo-miR-995

Accession numberMIMAT0045436
IDbdo-miR-995
Stem-Loop bdo-mir-995
Sequence
uagcaccacaugauucggcuu
Get sequence
Deep sequencing reads, experiments

References

1