Mature sequence bdo-miR-11

Accession numberMIMAT0045434
IDbdo-miR-11
Stem-Loop bdo-mir-11
Sequence
caucacagucugaguucuugcu
Get sequence
Deep sequencing reads, experiments

References

1