Mature sequence bdo-miR-12

Accession numberMIMAT0045423
IDbdo-miR-12
Stem-Loop bdo-mir-12
Sequence
ugaguauuacaucagguacugg
Get sequence
Deep sequencing reads, experiments

References

1