Mature sequence bdo-miR-5a

Accession numberMIMAT0045422
IDbdo-miR-5a
Stem-Loop bdo-mir-5a
Sequence
aaaggaacguucguugugauau
Get sequence
Deep sequencing reads, experiments

References

1