Mature sequence bdo-miR-2b

Accession numberMIMAT0045416
IDbdo-miR-2b
Stem-Loop bdo-mir-2b-2 bdo-mir-2b-1
Sequence
uaucacagccagcuuugaggagcg
Get sequence
Deep sequencing reads, experiments

References

1