Mature sequence bdo-miR-1

Accession numberMIMAT0045414
IDbdo-miR-1
Stem-Loop bdo-mir-1
Sequence
uggaauguaaagaaguauggag
Get sequence
Deep sequencing reads, experiments

References

1