Mature sequence bdo-miR-10

Accession numberMIMAT0045413
IDbdo-miR-10
Stem-Loop bdo-mir-10
Sequence
acccuguagauccgaauuuguu
Get sequence
Deep sequencing reads, experiments

References

1