Mature sequence bdo-miR-2c

Accession numberMIMAT0045373
IDbdo-miR-2c
Stem-Loop bdo-mir-2c
Sequence
ucacagccagcuuugaugagca
Get sequence
Deep sequencing reads, experiments

References

1