Mature sequence gmo-miR-17-5p

Accession numberMIMAT0044301
IDgmo-miR-17-5p
Stem-Loop gmo-mir-17-1 gmo-mir-17-2
Sequence
caaagugcuuacagugcaggua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25881242 "Temperature during early development has long-term effects on microRNA expression in Atlantic cod" Bizuayehu TT, Johansen SD, Puvanendran V, Toften H, Babiak I BMC Genomics. 16:305(2015).
2