Mature sequence lja-miR398-3p

Accession numberMIMAT0043859
IDlja-miR398-3p
Stem-Loop lja-MIR398
Sequence
uuguguucucaggucaccccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).