Mature sequence sfr-miR-92a-5p

Accession numberMIMAT0041864
IDsfr-miR-92a-5p
Stem-Loop sfr-mir-92a
Sequence
gggcggugacuggcgcuauau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).