Mature sequence gma-miR167l

Accession numberMIMAT0041654
IDgma-miR167l
Stem-Loop gma-MIR167l
Sequence
ugaagcugccagcaugaucu
Get sequence
Deep sequencing reads, experiments

References

1