Mature sequence ssc-miR-10390

Accession numberMIMAT0041603
IDssc-miR-10390
Stem-Loop ssc-mir-10390
Sequence
auacuacugacagaccgcaaccu
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).