Mature sequence bta-miR-219b-3p

Accession numberMIMAT0040926
IDbta-miR-219b-3p
Stem-Loop bta-mir-219b
Sequence
agaauugcguuuggacaaucagu
Get sequence
Deep sequencing506 reads, 34 experiments

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).